Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing sufA gene

Regulog: IscR - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Built upon 41 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Alcanivorax borkumensis SK2
Position: -45
Score: 6.19847
Locus tag: ABO_1865
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: ABO_1866
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: ABO_1867
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: ABO_1868
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: ABO_1869
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: ABO_1870
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: ABO_1871
Name: sufE
Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
sufB-sufC-sufD-sufS-sufA-sufT-sufE -45 6.2 ATACCCGACTAAATTACTCTGGTAT ABO_1865
Cellvibrio japonicus Ueda107
Position: -131
Score: 6.12287
Locus tag: CJA_1465
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: CJA_1466
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Locus tag: CJA_1467
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: CJA_1468
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: CJA_1469
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: CJA_1470
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: CJA_1471
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: CJA_1472
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
iscR-iscS-sufB-sufC-sufD-sufS-sufA-sufT -131 6.1 ATAGTTGAGTAAAATACTCGGGTTT CJA_1465
Marinobacter aqueolei
Position: -223
Score: 6.29932
Locus tag: Maqu_3151
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: Maqu_3152
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: Maqu_3153
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: Maqu_3154
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: Maqu_3155
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: Maqu_3156
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: Maqu_3157
Name: sufE
Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
sufB-sufC-sufD-sufS-sufA-sufT-sufE -223 6.3 ATACCTGACTATTTTACTCTGGTAT Maqu_3151
Marinobacter sp. ELB17
Position: -131
Score: 6.19847
Locus tag: MELB17_04217
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: MELB17_04212
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: MELB17_04207
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: MELB17_04202
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: MELB17_04197
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: MELB17_04192
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: MELB17_04187
Name: sufE
Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
sufB-sufC-sufD-sufS-sufA-sufT-sufE -131 6.2 ATACCTGACTAAAATACTCTGGTAT MELB17_04217
Marinomonas sp. MWYL1
Position: -93
Score: 5.50043
Position: -68
Score: 5.34063
Locus tag: Mmwyl1_1343
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Mmwyl1_1344
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: Mmwyl1_1345
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: Mmwyl1_1346
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: Mmwyl1_1347
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: Mmwyl1_1348
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: Mmwyl1_1349
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: Mmwyl1_1350
Name: sufE
Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
Locus tag: Mmwyl1_1351
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
iscR-sufB-sufC-sufD-sufS-sufA-sufT-sufE-iscS -93 5.5 ATAACCTACTAAAATAGTCAGGTAA Mmwyl1_1343
Oceanobacter sp. RED65
Position: -74
Score: 6.18819
Locus tag: RED65_06117
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: RED65_06112
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Locus tag: RED65_06107
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: RED65_06102
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: RED65_06097
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: RED65_06092
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: RED65_06087
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: RED65_06082
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
iscR-iscS-sufB-sufC-sufD-sufS-sufA-sufT -74 6.2 AAAGTTGACTAAAATACTCGGGTTT RED65_06117
Reinekea sp. MED297
Position: -107
Score: 6.33485
Locus tag: MED297_14930
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: MED297_14935
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Locus tag: MED297_14940
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: MED297_14945
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: MED297_14950
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: MED297_14955
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: MED297_14960
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: MED297_14965
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: MED297_14970
Name: sufE
Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
iscR-iscS-sufB-sufC-sufD-sufS-sufA-sufT-sufE -107 6.3 ATAGTTGACTGTTTTGCTCAGGTAT MED297_14930
Saccharophagus degradans 2-40
Position: -61
Score: 5.99801
Locus tag: Sde_1412
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Sde_1413
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Locus tag: Sde_1414
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: Sde_1415
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: Sde_1416
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: Sde_1417
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: Sde_1418
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: Sde_1419
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: Sde_1420
Name: sufE
Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
iscR-iscS-sufB-sufC-sufD-sufS-sufA-sufT-sufE -61 6 ATACTTGATTGAAATGCTAGGTTAT Sde_1412
Teredinibacter turnerae T7901
Position: -64
Score: 6.0626
Locus tag: TERTU_2649
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: TERTU_2648
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Locus tag: TERTU_2647
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: TERTU_2646
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: TERTU_2645
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: TERTU_2644
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: TERTU_2643
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: TERTU_2641
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: TERTU_2640
Name: sufE
Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
iscR-iscS-sufB-sufC-sufD-sufS-sufA-sufT-sufE -64 6.1 ATAGTTGACCGCATTACTCGGTTAT TERTU_2649