Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing iscS gene

Regulog: IscR - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Built upon 41 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Alcanivorax borkumensis SK2
Position: -66
Score: 6.01189
Locus tag: ABO_1873
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: ABO_1872
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Cellvibrio japonicus Ueda107
Position: -131
Score: 6.12287
Locus tag: CJA_1465
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: CJA_1466
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Locus tag: CJA_1467
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: CJA_1468
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: CJA_1469
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: CJA_1470
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: CJA_1471
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: CJA_1472
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
iscR-iscS-sufB-sufC-sufD-sufS-sufA-sufT -131 6.1 ATAGTTGAGTAAAATACTCGGGTTT CJA_1465
Chromohalobacter salexigens DSM 3043
Position: -71
Score: 4.98502
Locus tag: Csal_2847
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Csal_2848
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Locus tag: Csal_2849
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Hahella chejuensis KCTC 2396
Position: -59
Score: 4.97356
Locus tag: HCH_04462
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: HCH_04461
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Marinobacter aqueolei
Position: -78
Score: 5.93655
Locus tag: Maqu_1121
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Maqu_1122
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Marinobacter sp. ELB17
Position: -77
Score: 6.0661
Locus tag: MELB17_11313
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: MELB17_11318
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Marinomonas sp. MWYL1
Position: -93
Score: 5.50043
Position: -68
Score: 5.34063
Locus tag: Mmwyl1_1343
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Mmwyl1_1344
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: Mmwyl1_1345
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: Mmwyl1_1346
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: Mmwyl1_1347
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: Mmwyl1_1348
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: Mmwyl1_1349
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: Mmwyl1_1350
Name: sufE
Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
Locus tag: Mmwyl1_1351
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
iscR-sufB-sufC-sufD-sufS-sufA-sufT-sufE-iscS -93 5.5 ATAACCTACTAAAATAGTCAGGTAA Mmwyl1_1343
Oceanobacter sp. RED65
Position: -74
Score: 6.18819
Locus tag: RED65_06117
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: RED65_06112
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Locus tag: RED65_06107
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: RED65_06102
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: RED65_06097
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: RED65_06092
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: RED65_06087
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: RED65_06082
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
iscR-iscS-sufB-sufC-sufD-sufS-sufA-sufT -74 6.2 AAAGTTGACTAAAATACTCGGGTTT RED65_06117
Oceanospirillum sp. MED92
Position: -68
Score: 5.36451
Locus tag: MED92_00535
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: MED92_00540
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Locus tag: MED92_00545
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: MED92_00550
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: MED92_00555
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: MED92_00560
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: MED92_00565
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR-iscS-iscU-iscA-hscB-hscA-fdx -68 5.4 TTAATTGACCTTTTTGGTCGGGTAT MED92_00535
Reinekea sp. MED297
Position: -107
Score: 6.33485
Locus tag: MED297_14930
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: MED297_14935
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Locus tag: MED297_14940
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: MED297_14945
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: MED297_14950
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: MED297_14955
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: MED297_14960
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: MED297_14965
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: MED297_14970
Name: sufE
Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
iscR-iscS-sufB-sufC-sufD-sufS-sufA-sufT-sufE -107 6.3 ATAGTTGACTGTTTTGCTCAGGTAT MED297_14930
Saccharophagus degradans 2-40
Position: -61
Score: 5.99801
Locus tag: Sde_1412
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Sde_1413
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Locus tag: Sde_1414
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: Sde_1415
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: Sde_1416
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: Sde_1417
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: Sde_1418
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: Sde_1419
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: Sde_1420
Name: sufE
Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
iscR-iscS-sufB-sufC-sufD-sufS-sufA-sufT-sufE -61 6 ATACTTGATTGAAATGCTAGGTTAT Sde_1412
Teredinibacter turnerae T7901
Position: -64
Score: 6.0626
Locus tag: TERTU_2649
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: TERTU_2648
Name: iscS
Funciton: Cysteine desulfurase (EC, IscS subfamily
Locus tag: TERTU_2647
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: TERTU_2646
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: TERTU_2645
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: TERTU_2644
Name: sufS
Funciton: Cysteine desulfurase (EC, SufS subfamily
Locus tag: TERTU_2643
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: TERTU_2641
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: TERTU_2640
Name: sufE
Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly
iscR-iscS-sufB-sufC-sufD-sufS-sufA-sufT-sufE -64 6.1 ATAGTTGACCGCATTACTCGGTTAT TERTU_2649