Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing nfuA gene

Properties
Regulog: IscR - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Built upon 41 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Alcanivorax borkumensis SK2
Position: -101
Score: 5.5031
Sequence: GTACCTGACTAAAATAGTCAGGAAA
Locus tag: ABO_1190
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA -101 5.5 GTACCTGACTAAAATAGTCAGGAAA ABO_1190
Cellvibrio japonicus Ueda107
Position: -66
Score: 5.64321
Sequence: ATACCCGAGTATTTTAATCAGGTAT
Locus tag: CJA_2541
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA -66 5.6 ATACCCGAGTATTTTAATCAGGTAT CJA_2541
Hahella chejuensis KCTC 2396
Position: -86
Score: 5.10512
Sequence: AAATCCTACTAATTTGCTAAGGCTT
Locus tag: HCH_02543
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA -86 5.1 AAATCCTACTAATTTGCTAAGGCTT HCH_02543
Marinobacter aqueolei
Position: -82
Score: 5.54031
Sequence: ATGCCCGACTATTTTACTTGGTCTT
Locus tag: Maqu_1525
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA -82 5.5 ATGCCCGACTATTTTACTTGGTCTT Maqu_1525
Marinomonas sp. MWYL1
Position: -93
Score: 5.34915
Sequence: ATACCCTACTTTTTTACTTGGTCTT
Locus tag: Mmwyl1_2344
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA -93 5.3 ATACCCTACTTTTTTACTTGGTCTT Mmwyl1_2344
Oceanobacter sp. RED65
Position: -78
Score: 5.2824
Sequence: ATACCCGAGTAAAAAACTAGGGATT
Locus tag: RED65_07139
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA -78 5.3 ATACCCGAGTAAAAAACTAGGGATT RED65_07139
Oceanospirillum sp. MED92
Position: -79
Score: 6.05126
Sequence: ATAGTTGATCAATTTACTCGGGATT
Locus tag: MED92_12256
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA -79 6.1 ATAGTTGATCAATTTACTCGGGATT MED92_12256
Reinekea sp. MED297
Position: -86
Score: 6.23541
Sequence: AAAGCTGACTAAATTACTCAGGTAT
Locus tag: MED297_01820
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA -86 6.2 AAAGCTGACTAAATTACTCAGGTAT MED297_01820
Saccharophagus degradans 2-40
Position: -38
Score: 5.43569
Sequence: ATAACCGACAAATTTACTAGGTCTT
Locus tag: Sde_2009
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA -38 5.4 ATAACCGACAAATTTACTAGGTCTT Sde_2009
Teredinibacter turnerae T7901
Position: -69
Score: 5.84963
Sequence: ATACCCAACTAAATTAGTAGGGTAT
Locus tag: TERTU_2127
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA -69 5.8 ATACCCAACTAAATTAGTAGGGTAT TERTU_2127