Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing erpA gene

Properties
Regulog: IscR - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Built upon 41 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Alcanivorax borkumensis SK2
Position: 9
Score: 5.7525
Sequence: ATTCTTGACTGTTTTAGTCGGGTAC
Locus tag: ABO_0362
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA 9 5.8 ATTCTTGACTGTTTTAGTCGGGTAC ABO_0362
Cellvibrio japonicus Ueda107
Position: -76
Score: 6.00973
Sequence: ATAGTTGACTGTTTTGCTGGGGTAA
Locus tag: CJA_0888
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA -76 6 ATAGTTGACTGTTTTGCTGGGGTAA CJA_0888
Chromohalobacter salexigens DSM 3043
Position: -76
Score: 5.50745
Sequence: AAAGTTGACCGTTTTGCTTGGTCTT
Locus tag: Csal_3299
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA -76 5.5 AAAGTTGACCGTTTTGCTTGGTCTT Csal_3299
Hahella chejuensis KCTC 2396
Position: -103
Score: 5.48366
Sequence: ATAGTTGACCGATTAAGTAGGATAA
Locus tag: HCH_06242
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA -103 5.5 ATAGTTGACCGATTAAGTAGGATAA HCH_06242
Marinobacter aqueolei
Position: -87
Score: 6.03067
Sequence: ATAGTTGATTGTTTTAGTCAGGAAT
Locus tag: Maqu_0694
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA -87 6 ATAGTTGATTGTTTTAGTCAGGAAT Maqu_0694
Marinobacter sp. ELB17
Position: -66
Score: 6.03067
Sequence: ATAGTTGATTGTTTTAGTCAGGAAT
Locus tag: MELB17_20316
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA -66 6 ATAGTTGATTGTTTTAGTCAGGAAT MELB17_20316
Marinomonas sp. MWYL1
Position: -66
Score: 6.2935
Sequence: ATACTTGACTAAATTACTCGGATAA
Locus tag: Mmwyl1_1012
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA -66 6.3 ATACTTGACTAAATTACTCGGATAA Mmwyl1_1012
Oceanobacter sp. RED65
Position: -70
Score: 5.74346
Sequence: TTAGTTGACTAGAATACTCGGGTTT
Locus tag: RED65_11832
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA -70 5.7 TTAGTTGACTAGAATACTCGGGTTT RED65_11832
Oceanospirillum sp. MED92
Position: -61
Score: 6.06413
Sequence: ATACTTGACTGAATTGCTTGGTTAA
Locus tag: MED92_17445
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA -61 6.1 ATACTTGACTGAATTGCTTGGTTAA MED92_17445
Reinekea sp. MED297
Position: -63
Score: 6.33485
Sequence: ATAGTTGACTGTTTTGCTCAGGTAT
Locus tag: MED297_10476
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA -63 6.3 ATAGTTGACTGTTTTGCTCAGGTAT MED297_10476
Saccharophagus degradans 2-40
Position: -66
Score: 6.10036
Sequence: ATACTTGATTGTTTTAGTCGGTTAA
Locus tag: Sde_0836
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA -66 6.1 ATACTTGATTGTTTTAGTCGGTTAA Sde_0836
Teredinibacter turnerae T7901
Position: -86
Score: 5.8464
Sequence: ATACTTGACTGAAACACTCGGGTAC
Locus tag: TERTU_3061
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA -86 5.8 ATACTTGACTGAAACACTCGGGTAC TERTU_3061