Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ydhD gene

Properties
Regulog: IscR - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Built upon 41 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Cellvibrio japonicus Ueda107
Position: -74
Score: 5.97721
Sequence: ATACTTGACTGCATTACTTGGTTTT
Locus tag: CJA_2843
Name: ydhD
Funciton: Probable monothiol glutaredoxin ydhD
ydhD -74 6 ATACTTGACTGCATTACTTGGTTTT CJA_2843
Reinekea sp. MED297
Position: -25
Score: 5.40641
Sequence: ATATCTGAGCGATTTGGTAGGTTAT
Locus tag: MED297_14062
Name: ydhD
Funciton: Probable monothiol glutaredoxin ydhD
ydhD -25 5.4 ATATCTGAGCGATTTGGTAGGTTAT MED297_14062
Saccharophagus degradans 2-40
Position: -68
Score: 5.36613
Sequence: ATACCCGAGTAAATAACTCAGATTT
Locus tag: Sde_2438
Name: ydhD
Funciton: Probable monothiol glutaredoxin ydhD
ydhD -68 5.4 ATACCCGAGTAAATAACTCAGATTT Sde_2438