Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing omr gene

Properties
Regulog: Zur - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 36 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Hyphomonas neptunium ATCC 15444
Position: -44
Score: 5.35347
Sequence: GTAATGCAATATTATTACATTAC
Locus tag: HNE_1973
Name: omr
Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
omr -44 5.4 GTAATGCAATATTATTACATTAC HNE_1973
Oceanicaulis alexandrii HTCC2633
Position: -52
Score: 5.72644
Sequence: GTGACGTTATGACATTACGTAAC
Locus tag: OA2633_05989
Name: omr
Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
omr -52 5.7 GTGACGTTATGACATTACGTAAC OA2633_05989