Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing trxR gene

Properties
Regulog: Zur - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 36 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oceanicola batsensis HTCC2597
Position: -116
Score: 4.96429
Sequence: GTAACGTGATATCATAACCACAT
Locus tag: OB2597_20976
Name: trxR
Funciton: Thioredoxin reductase (EC 1.8.1.9)
Locus tag: OB2597_20981
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
trxR-yciC -116 5 GTAACGTGATATCATAACCACAT OB2597_20976