Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing yciC gene

Properties
Regulog: Zur - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 36 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oceanicola batsensis HTCC2597
Position: -116
Score: 4.96429
Sequence: GTAACGTGATATCATAACCACAT
Locus tag: OB2597_20976
Name: trxR
Funciton: Thioredoxin reductase (EC 1.8.1.9)
Locus tag: OB2597_20981
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
trxR-yciC -116 5 GTAACGTGATATCATAACCACAT OB2597_20976
Paracoccus denitrificans PD1222
Position: -33
Score: 5.69029
Sequence: GTAACGTAATAACATTACATTTA
Locus tag: Pden_1338
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
yciC -33 5.7 GTAACGTAATAACATTACATTTA Pden_1338
Roseovarius nubinhibens ISM
Position: -71
Score: 5.40966
Sequence: GTGATGTTATACTATAACAGATT
Locus tag: ISM_00325
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
yciC -71 5.4 GTGATGTTATACTATAACAGATT ISM_00325
Silicibacter TM1040
Position: -38
Score: 5.37873
Sequence: TGATTGTTATCTTATAACATTTC
Locus tag: TM1040_0080
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
yciC -38 5.4 TGATTGTTATCTTATAACATTTC TM1040_0080