Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing zinT gene

Properties
Regulog: Zur - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 36 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodobacter sphaeroides 2.4.1
Position: -62
Score: 5.9104
Sequence: GATATGTAATAACATATCATATA
Locus tag: RSP_3117
Name: zinT
Funciton: Candidate zinc-binding lipoprotein ZinT
zinT -62 5.9 GATATGTAATAACATATCATATA RSP_3117
Roseovarius nubinhibens ISM
Position: -34
Score: 5.21682
Sequence: GCTACGTTATATCATAACTACTT
Locus tag: ISM_05645
Name: zinT
Funciton: Candidate zinc-binding lipoprotein ZinT
zinT -34 5.2 GCTACGTTATATCATAACTACTT ISM_05645
Silicibacter TM1040
Position: -36
Score: 5.6168
Sequence: AACGTGTTATAACATAACGAATC
Locus tag: TM1040_0201
Name: zinT
Funciton: Candidate zinc-binding lipoprotein ZinT
zinT -36 5.6 AACGTGTTATAACATAACGAATC TM1040_0201
Sulfitobacter sp. EE-36
Position: -54
Score: 6.05123
Sequence: GTTACGTTATAACATAACGAATC
Locus tag: EE36_11254
Name: zinT
Funciton: Candidate zinc-binding lipoprotein ZinT
zinT -54 6.1 GTTACGTTATAACATAACGAATC EE36_11254