Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing znuA gene

Properties
Regulog: Zur - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 36 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -61
Score: 5.3734
Sequence: GTCATGTTATTTCATATCAGTTA
Locus tag: Jann_0312
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -61 5.4 GTCATGTTATTTCATATCAGTTA Jann_0312
Loktanella vestfoldensis SKA53
Position: -63
Score: 5.69206
Sequence: GCCTTGTTATGATATAACATATC
Locus tag: SKA53_01411
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -63 5.7 GCCTTGTTATGATATAACATATC SKA53_01411
Oceanicola batsensis HTCC2597
Position: -30
Score: 5.20775
Sequence: GCAATGTTATCTTATAACAGGAA
Locus tag: OB2597_14476
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -30 5.2 GCAATGTTATCTTATAACAGGAA OB2597_14476
Oceanicola granulosus HTCC2516
Position: -63
Score: 5.08839
Sequence: GGGTTGTTACGTTATAACATCTC
Locus tag: OG2516_06072
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -63 5.1 GGGTTGTTACGTTATAACATCTC OG2516_06072
Paracoccus denitrificans PD1222
Position: -83
Score: 5.41792
Sequence: ATGATGTTATATCGTTACATTTT
Locus tag: Pden_4140
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -83 5.4 ATGATGTTATATCGTTACATTTT Pden_4140
Rhodobacter sphaeroides 2.4.1
Position: -55
Score: 5.38708
Sequence: GACGCGTTATGATATAACGTAAT
Locus tag: RSP_3571
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -55 5.4 GACGCGTTATGATATAACGTAAT RSP_3571
Rhodobacterales bacterium HTCC2654
Position: -59
Score: 5.24343
Sequence: GATGCGTTATGATATTACAGATA
Locus tag: RB2654_20868
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -59 5.2 GATGCGTTATGATATTACAGATA RB2654_20868
Roseobacter sp. MED193
Position: -66
Score: 5.55941
Sequence: GAGATGTTATAAAATTACATGAG
Locus tag: MED193_01520
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -66 5.6 GAGATGTTATAAAATTACATGAG MED193_01520
Roseovarius nubinhibens ISM
Position: -115
Score: 5.50557
Sequence: GATATGTTATATTATCTCATCTA
Locus tag: ISM_14180
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -115 5.5 GATATGTTATATTATCTCATCTA ISM_14180
Roseovarius sp. 217
Position: -32
Score: 5.28037
Sequence: TGAATGTTATGATATCACATATG
Locus tag: ROS217_23037
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -32 5.3 TGAATGTTATGATATCACATATG ROS217_23037
Silicibacter TM1040
Position: -36
Score: 5.28632
Sequence: ATAACGTTATGATATAACACCAG
Locus tag: TM1040_3616
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -36 5.3 ATAACGTTATGATATAACACCAG TM1040_3616
Silicibacter pomeroyi DSS-3
Position: -65
Score: 5.21105
Sequence: GGCTTGATATGTTATAACATCCC
Locus tag: SPO0987
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -65 5.2 GGCTTGATATGTTATAACATCCC SPO0987
Sulfitobacter sp. EE-36
Position: -64
Score: 5.27605
Sequence: GTGTTGATATGTTATAACGTGTG
Locus tag: EE36_13038
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -64 5.3 GTGTTGATATGTTATAACGTGTG EE36_13038