Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing znuC gene

Regulog: Zur - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 36 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -18
Score: 5.18003
Locus tag: Jann_0313
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: Jann_0314
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Jann_0315
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -18 5.2 TAACTGATATGAAATAACATGAC Jann_0313
Loktanella vestfoldensis SKA53
Position: -29
Score: 6.00744
Locus tag: SKA53_01416
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: SKA53_01421
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: SKA53_01426
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Oceanicola batsensis HTCC2597
Position: -55
Score: 5.26311
Locus tag: OB2597_14481
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: OB2597_14486
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: OB2597_14491
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -55 5.3 TTCCTGTTATAAGATAACATTGC OB2597_14481
Oceanicola granulosus HTCC2516
Position: -35
Score: 5.66994
Locus tag: OG2516_06067
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: OG2516_06062
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: OG2516_06057
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -35 5.7 GAGATGTTATAACGTAACAACCC OG2516_06067
Paracoccus denitrificans PD1222
Position: -49
Score: 5.31371
Locus tag: Pden_4139
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: Pden_4138
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Pden_4137
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -49 5.3 TTTATGTTATATCGTAACCCGTC Pden_4139
Rhodobacter sphaeroides 2.4.1
Position: -24
Score: 5.68874
Locus tag: RSP_3569
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: RSP_3568
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: RSP_3567
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Rhodobacterales bacterium HTCC2654
Position: -35
Score: 5.45566
Locus tag: RB2654_20873
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: RB2654_20878
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: RB2654_20883
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -35 5.5 TATCTGTAATATCATAACGCATC RB2654_20873
Roseobacter sp. MED193
Position: -111
Score: 5.56808
Locus tag: MED193_01515
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: MED193_01510
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MED193_01505
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -111 5.6 CTCATGTAATTTTATAACATCTC MED193_01515
Roseovarius nubinhibens ISM
Position: -54
Score: 5.63892
Locus tag: ISM_14175
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: ISM_14170
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: ISM_14165
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Roseovarius sp. 217
Position: -98
Score: 5.50582
Locus tag: ROS217_23042
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: ROS217_23047
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: ROS217_23052
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -98 5.5 CATATGTGATATCATAACATTCA ROS217_23042
Silicibacter TM1040
Position: -86
Score: 5.48256
Locus tag: TM1040_3615
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: TM1040_3614
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: TM1040_3613
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -86 5.5 CTGGTGTTATATCATAACGTTAT TM1040_3615
Silicibacter pomeroyi DSS-3
Position: -45
Score: 5.59122
Locus tag: SPO0986
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: SPO0985
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: SPO0984
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Sulfitobacter sp. EE-36
Position: -47
Score: 5.48231
Locus tag: EE36_13033
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: EE36_13028
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: EE36_13023
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -47 5.5 CACACGTTATAACATATCAACAC EE36_13033