Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing znuB gene

Regulog: Zur - Comamonadaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Polaromonas naphthalenivorans CJ2
Position: -251
Score: 6.54155
Position: -219
Score: 6.12467
Locus tag: Pnap_1144
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Pnap_1143
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Pnap_1142
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC-znuB-znuA -251 6.5 TTAATGCAATTCAGTTGCGTTAC Pnap_1144
Rhodoferax ferrireducens DSM 15236
Position: -277
Score: 6.38423
Position: -251
Score: 6.62261
Locus tag: Rfer_2053
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Rfer_2052
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Rfer_2051
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC-znuB-znuA -277 6.4 TTATTGCAATTGAGTTGCGTTAA Rfer_2053