Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing folE2 gene

Properties
Regulog: Zur - Moraxellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acinetobacter sp. ADP1
Position: -128
Score: 6.44328
Sequence: TATATGTTACATTATAACATAAC
Locus tag: ACIAD1741
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: ACIAD1740
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
yciC-folE2 -128 6.4 TATATGTTACATTATAACATAAC ACIAD1741