Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ACIAD1742 gene

Properties
Regulog: Zur - Moraxellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acinetobacter sp. ADP1
Position: -44
Score: 5.12065
Sequence: CCAATGTTATAATGTAACAGTTA
Locus tag: ACIAD1742
Name: null
Funciton: hypothetical protein; putative signal peptide
ACIAD1742 -44 5.1 CCAATGTTATAATGTAACAGTTA ACIAD1742