Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing pyrC2 gene

Properties
Regulog: Zur - Moraxellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acinetobacter sp. ADP1
Position: -101
Score: 6.32285
Sequence: TATTTGTTATGTTATAACATAAC
Locus tag: ACIAD1420
Name: can
Funciton: Carbonic anhydrase, gamma class (EC 4.2.1.1)
Locus tag: ACIAD1419
Name: ACIAD1419
Funciton: Dihydroorotase (EC 3.5.2.3)
can-ACIAD1419 -101 6.3 TATTTGTTATGTTATAACATAAC ACIAD1420