Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing tonB gene

Properties
Regulog: Zur - Moraxellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acinetobacter sp. ADP1
Position: -253
Score: 5.70807
Sequence: AAAGTATTATGTTATAACATAAT
Locus tag: ACIAD0507
Name: tonB
Funciton: Ferric siderophore transport system, periplasmic binding protein TonB
Locus tag: ACIAD0508
Name: exbB
Funciton: MotA/TolQ/ExbB proton channel family protein
Locus tag: ACIAD0509
Name: exbD
Funciton: Biopolymer transport protein ExbD/TolR
tonB-exbB-exbD -253 5.7 AAAGTATTATGTTATAACATAAT ACIAD0507