Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Psyc_1790 gene

Properties
Regulog: Zur - Moraxellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Psychrobacter arcticum 273-4
Position: -165
Score: 5.67059
Sequence: AAATTGATATATTATAAAATAAT
Locus tag: Psyc_1790
Name: Psyc_1790
Funciton: Zn-dependent hydrolases, including glyoxylases
Psyc_1790 -165 5.7 AAATTGATATATTATAAAATAAT Psyc_1790