Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing znuA2 gene

Properties
Regulog: Zur - Moraxellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Psychrobacter sp. PRwf-1
Position: -100
Score: 6.37037
Sequence: TTATTGTTATAATATAACATACT
Locus tag: PsycPRwf_1910
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA2 -100 6.4 TTATTGTTATAATATAACATACT PsycPRwf_1910