Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing omr1 gene

Properties
Regulog: Zur - Moraxellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acinetobacter baumannii AB0057
Position: -51
Score: 6.71441
Sequence: GAAATGTTATAATATAACAAAAC
Locus tag: AB57_3396
Name: omr1
Funciton: Zinc-regulated outer membrane receptor
omr1 -51 6.7 GAAATGTTATAATATAACAAAAC AB57_3396
Acinetobacter sp. ADP1
Position: -64
Score: 6.191
Sequence: GCAATGTTATAATATTACAAAAA
Locus tag: ACIAD0611
Name: omr1
Funciton: Zinc-regulated outer membrane receptor
omr1 -64 6.2 GCAATGTTATAATATTACAAAAA ACIAD0611
Psychrobacter sp. PRwf-1
Position: -86
Score: 6.80324
Sequence: GTTATGTTATAGTATAACATAAC
Locus tag: PsycPRwf_2340
Name: omr1
Funciton: Zinc-regulated outer membrane receptor
omr1 -86 6.8 GTTATGTTATAGTATAACATAAC PsycPRwf_2340