Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rpmJ gene

Properties
Regulog: Zur - Moraxellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Psychrobacter sp. PRwf-1
Position: -121
Score: 6.59972
Sequence: TTAATGTTATGTTATAACATAAT
Locus tag: PsycPRwf_1926
Name: PsycPRwf_1926
Funciton: LSU ribosomal protein L36p
PsycPRwf_1926 -121 6.6 TTAATGTTATGTTATAACATAAT PsycPRwf_1926