Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rpmE2 gene

Properties
Regulog: Zur - Moraxellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acinetobacter baumannii AB0057
Position: -54
Score: 6.00088
Sequence: TGAGTGTTATGTTATAACATTTC
Locus tag: AB57_0468
Name: rpmE2
Funciton: LSU ribosomal protein L31p
rpmE2 -54 6 TGAGTGTTATGTTATAACATTTC AB57_0468
Acinetobacter sp. ADP1
Position: -54
Score: 6.17714
Sequence: AAAATGAAATAATATAACATTAC
Locus tag: ACIAD0425
Name: rpmE2
Funciton: LSU ribosomal protein L31p
rpmE2 -54 6.2 AAAATGAAATAATATAACATTAC ACIAD0425