Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing znuC gene

Regulog: Zur - Moraxellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acinetobacter baumannii AB0057
Position: -111
Score: 5.93125
Locus tag: AB57_0184
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: AB57_0183
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: AB57_0182
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -111 5.9 AGCATGTTATAATATAACAAAGT AB57_0184
Acinetobacter sp. ADP1
Position: -97
Score: 6.10945
Locus tag: ACIAD0176
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: ACIAD0175
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: ACIAD0174
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Psychrobacter arcticum 273-4
Position: -187
Score: 6.76161
Locus tag: Psyc_2033
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: Psyc_2034
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Psyc_2035
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -187 6.8 ATTATGTTATACTATAACATAAT Psyc_2033
Psychrobacter sp. PRwf-1
Position: -408
Score: 5.80252
Locus tag: PsycPRwf_0184
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: PsycPRwf_0183
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: PsycPRwf_0182
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -408 5.8 GATATGTTATACTATAACTAATA PsycPRwf_0184