Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing znuA gene

Properties
Regulog: Zur - Moraxellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acinetobacter baumannii AB0057
Position: -51
Score: 5.81642
Sequence: ACTTTGTTATATTATAACATGCT
Locus tag: AB57_0185
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -51 5.8 ACTTTGTTATATTATAACATGCT AB57_0185
Acinetobacter sp. ADP1
Position: -36
Score: 5.65671
Sequence: AATTTGTTATAATATAACACAAG
Locus tag: ACIAD0177
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -36 5.7 AATTTGTTATAATATAACACAAG ACIAD0177
Psychrobacter arcticum 273-4
Position: -83
Score: 6.80324
Sequence: ATTATGTTATAGTATAACATAAT
Locus tag: Psyc_2032
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -83 6.8 ATTATGTTATAGTATAACATAAT Psyc_2032
Psychrobacter sp. PRwf-1
Position: -142
Score: 6.09874
Sequence: TATTAGTTATAGTATAACATATC
Locus tag: PsycPRwf_0185
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -142 6.1 TATTAGTTATAGTATAACATATC PsycPRwf_0185