Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing PF08856 gene

Properties
Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Alcanivorax borkumensis SK2
Position: -34
Score: 5.74466
Sequence: GCAATGTTATAACATAACATGAA
Locus tag: ABO_1680
Name: dksA2
Funciton: C4-type zinc finger protein, DksA/TraR family
Locus tag: ABO_1679
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: ABO_1678
Name: PF08856
Funciton: hypothetical protein
Locus tag: ABO_1677
Name: zur2
Funciton: Zinc uptake regulation protein ZUR
Locus tag: ABO_1676
Name: null
Funciton: hypothetical protein
Locus tag: ABO_1675
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: ABO_1674
Name: null
Funciton: Methionine ABC transporter ATP-binding protein
Locus tag: ABO_1673
Name: null
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: ABO_1672
Name: null
Funciton: lipoprotein, putative
dksA2-yciC-PF08856-zur2-ABO_1676-zbp-ABO_1674-ABO_1673-ABO_1672 -34 5.7 GCAATGTTATAACATAACATGAA ABO_1680
Marinomonas sp. MWYL1
Position: -23
Score: 4.6425
Sequence: TTTGTAAAATGTTATAACGTAAC
Position: -18
Score: 5.81457
Sequence: AAAATGTTATAACGTAACATGTT
Locus tag: Mmwyl1_0929
Name: PF08856
Funciton: hypothetical protein
PF08856 -23 4.6 TTTGTAAAATGTTATAACGTAAC Mmwyl1_0929
-18 5.8 AAAATGTTATAACGTAACATGTT
Oceanobacter sp. RED65
Position: -52
Score: 5.38233
Sequence: CAAAAGATATAATATATCATATC
Position: -47
Score: 4.98884
Sequence: GATATAATATATCATATCTTTTA
Locus tag: RED65_11939
Name: PF08856
Funciton: hypothetical protein
PF08856 -52 5.4 CAAAAGATATAATATATCATATC RED65_11939
-47 5 GATATAATATATCATATCTTTTA
Oceanospirillum sp. MED92
Position: -49
Score: 5.07664
Sequence: TTAAAGTTATGTTATATTGTATC
Position: -44
Score: 5.68613
Sequence: GTTATGTTATATTGTATCTTTTT
Locus tag: MED92_08311
Name: PF08856
Funciton: hypothetical protein
PF08856 -49 5.1 TTAAAGTTATGTTATATTGTATC MED92_08311
-44 5.7 GTTATGTTATATTGTATCTTTTT
Saccharophagus degradans 2-40
Position: -184
Score: 5.59838
Sequence: ATAATGATATCATATATCATATC
Locus tag: Sde_1980
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: Sde_1979
Name: PF08856
Funciton: hypothetical protein
yciC-PF08856 -184 5.6 ATAATGATATCATATATCATATC Sde_1980
Teredinibacter turnerae T7901
Position: -119
Score: 5.46445
Sequence: ATAATGATATGGTATATCATAAC
Position: -114
Score: 6.02538
Sequence: GATATGGTATATCATAACGTTAC
Locus tag: TERTU_2263
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: TERTU_2264
Name: PF08856
Funciton: hypothetical protein
yciC-PF08856 -119 5.5 ATAATGATATGGTATATCATAAC TERTU_2263
-114 6 GATATGGTATATCATAACGTTAC