Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing can gene

Properties
Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Alcanivorax borkumensis SK2
Position: -56
Score: 5.70028
Sequence: TTCATGTTATGTTATAACATTGC
Position: -51
Score: 4.85293
Sequence: GTTATGTTATAACATTGCATCAA
Locus tag: ABO_1681
Name: null
Funciton: hypothetical protein
Locus tag: ABO_1682
Name: can
Funciton: Carbonic anhydrase (EC 4.2.1.1)
Locus tag: ABO_1683
Name: pyrC2
Funciton: Dihydroorotase (EC 3.5.2.3)
ABO_1681-can-pyrC2 -56 5.7 TTCATGTTATGTTATAACATTGC ABO_1681
-51 4.9 GTTATGTTATAACATTGCATCAA
Oceanospirillum sp. MED92
Position: -152
Score: 5.711
Sequence: TAAATGTTATACCATAACAATAT
Position: -49
Score: 5.51568
Sequence: TAATTGCTATATTATAACATTGC
Locus tag: MED92_02993
Name: pyrC2
Funciton: Dihydroorotase (EC 3.5.2.3)
Locus tag: MED92_02988
Name: can
Funciton: Carbonic anhydrase (EC 4.2.1.1)
pyrC2-can -152 5.7 TAAATGTTATACCATAACAATAT MED92_02993
-49 5.5 TAATTGCTATATTATAACATTGC