Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing folE2 gene

Properties
Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chromohalobacter salexigens DSM 3043
Position: -90
Score: 5.87968
Sequence: AGAATGTTATGGTATAACATATC
Locus tag: Csal_0192
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: Csal_0191
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
yciC-folE2 -90 5.9 AGAATGTTATGGTATAACATATC Csal_0192
Hahella chejuensis KCTC 2396
Position: -211
Score: 5.70579
Sequence: AAAAAGATATGATATAACGTATC
Position: -206
Score: 5.17965
Sequence: GATATGATATAACGTATCTTTAT
Locus tag: HCH_01703
Name: zur2
Funciton: Zinc uptake regulation protein ZUR
Locus tag: HCH_10001
Name: hisI2
Funciton: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
Locus tag: HCH_01704
Name: pyrC2
Funciton: Dihydroorotase (EC 3.5.2.3)
Locus tag: HCH_01706
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
Locus tag: HCH_01707
Name: dksA2
Funciton: C4-type zinc finger protein, DksA/TraR family
zur2-hisI2-pyrC2-folE2-dksA2 -211 5.7 AAAAAGATATGATATAACGTATC HCH_01703
-206 5.2 GATATGATATAACGTATCTTTAT