Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing HCH_02943 gene

Properties
Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Hahella chejuensis KCTC 2396
Position: -66
Score: 4.93623
Sequence: AAAAAGATATGATGCAACATATC
Locus tag: HCH_02943
Name: null
Funciton: hypothetical protein
Locus tag: HCH_02944
Name: omr
Funciton: Zinc-regulated TonB-dependent outer membrane receptor
Locus tag: HCH_02945
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: HCH_02946
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
HCH_02943-omr-znuA2-znuB2 -66 4.9 AAAAAGATATGATGCAACATATC HCH_02943