Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing zbp gene

Properties
Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Hahella chejuensis KCTC 2396
Position: -70
Score: 5.71739
Sequence: GTTTCGTTATGTTATAACATAAA
Locus tag: HCH_00656
Name: zbp
Funciton: Predicted zinc-binding protein
zbp -70 5.7 GTTTCGTTATGTTATAACATAAA HCH_00656
Marinobacter aqueolei
Position: -39
Score: 5.60099
Sequence: AAAATGTTATAACATATCAAATA
Locus tag: Maqu_3429
Name: zbp
Funciton: Predicted zinc-binding protein
zbp -39 5.6 AAAATGTTATAACATATCAAATA Maqu_3429
Marinobacter sp. ELB17
Position: -34
Score: 5.86207
Sequence: AAGATGTTATAACATAACTTTAC
Locus tag: MELB17_02870
Name: zbp
Funciton: Predicted zinc-binding protein
zbp -34 5.9 AAGATGTTATAACATAACTTTAC MELB17_02870
Oceanospirillum sp. MED92
Position: -28
Score: 5.68266
Sequence: TTGTTGTTATATTATAACTTTTA
Locus tag: MED92_15318
Name: zbp
Funciton: Predicted zinc-binding protein
zbp -28 5.7 TTGTTGTTATATTATAACTTTTA MED92_15318