Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing zbp gene

Properties
Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Alcanivorax borkumensis SK2
Position: -34
Score: 5.74466
Sequence: GCAATGTTATAACATAACATGAA
Locus tag: ABO_1680
Name: dksA2
Funciton: C4-type zinc finger protein, DksA/TraR family
Locus tag: ABO_1679
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: ABO_1678
Name: PF08856
Funciton: hypothetical protein
Locus tag: ABO_1677
Name: zur2
Funciton: Zinc uptake regulation protein ZUR
Locus tag: ABO_1676
Name: null
Funciton: hypothetical protein
Locus tag: ABO_1675
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: ABO_1674
Name: null
Funciton: Methionine ABC transporter ATP-binding protein
Locus tag: ABO_1673
Name: null
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: ABO_1672
Name: null
Funciton: lipoprotein, putative
dksA2-yciC-PF08856-zur2-ABO_1676-zbp-ABO_1674-ABO_1673-ABO_1672 -34 5.7 GCAATGTTATAACATAACATGAA ABO_1680