Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing zur2 gene

Properties
Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Reinekea sp. MED297
Position: -77
Score: 5.85057
Sequence: TTAATGATATATCATATCATTTA
Locus tag: MED297_00400
Name: zur2
Funciton: Zinc uptake regulation protein paralog
zur2 -77 5.9 TTAATGATATATCATATCATTTA MED297_00400