Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rpmE2 gene

Properties
Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oceanospirillum sp. MED92
Position: -138
Score: 5.26583
Sequence: GCAATGTTATAATATAGCAATTA
Position: -35
Score: 5.90339
Sequence: ATATTGTTATGGTATAACATTTA
Locus tag: MED92_02998
Name: null
Funciton: ribosomal protein, L31P family protein
MED92_02998 -138 5.3 GCAATGTTATAATATAGCAATTA MED92_02998
-35 5.9 ATATTGTTATGGTATAACATTTA