Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing yciC gene

Properties
Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Reinekea sp. MED297
Position: -124
Score: 5.38642
Sequence: TAAATGATATGATGTATCATAAC
Position: -119
Score: 5.15138
Sequence: GATATGATGTATCATAACAAATA
Locus tag: MED297_11285
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MED297_11290
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: MED297_11295
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: MED297_11300
Name: PF08856
Funciton: hypothetical protein
Locus tag: MED297_11305
Name: zur
Funciton: Zinc uptake regulation protein ZUR
znuC-znuB-yciC-PF08856-zur -124 5.4 TAAATGATATGATGTATCATAAC MED297_11285
-119 5.2 GATATGATGTATCATAACAAATA