Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Mmwyl1_0291 gene

Properties
Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Marinomonas sp. MWYL1
Position: -51
Score: 5.20792
Sequence: TACTTGTTATATCATAACAAAAT
Locus tag: Mmwyl1_0291
Name: null
Funciton: putative membrane protein
Locus tag: Mmwyl1_0292
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: Mmwyl1_0293
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Mmwyl1_0294
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Mmwyl1_0291-zur-znuC-znuB -51 5.2 TACTTGTTATATCATAACAAAAT Mmwyl1_0291