Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing znuB gene

Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Cellvibrio japonicus Ueda107
Position: -53
Score: 5.27147
Locus tag: CJA_3482
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: CJA_3483
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: CJA_3484
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Chromohalobacter salexigens DSM 3043
Position: -56
Score: 5.86682
Locus tag: Csal_0189
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Csal_0190
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Hahella chejuensis KCTC 2396
Position: -80
Score: 5.34799
Locus tag: HCH_00537
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: HCH_00536
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: HCH_00535
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Marinobacter sp. ELB17
Position: -102
Score: 5.5346
Locus tag: MELB17_12886
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MELB17_12881
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Marinomonas sp. MWYL1
Position: -51
Score: 5.20792
Locus tag: Mmwyl1_0291
Name: null
Funciton: putative membrane protein
Locus tag: Mmwyl1_0292
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: Mmwyl1_0293
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Mmwyl1_0294
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Mmwyl1_0291-zur-znuC-znuB -51 5.2 TACTTGTTATATCATAACAAAAT Mmwyl1_0291
Oceanospirillum sp. MED92
Position: -43
Score: 5.60068
Locus tag: MED92_05843
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: MED92_05838
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MED92_05833
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -43 5.6 TTAAAGTTACAATATAACACAAA MED92_05843
Reinekea sp. MED297
Position: -124
Score: 5.38642
Position: -119
Score: 5.15138
Locus tag: MED297_11285
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MED297_11290
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: MED297_11295
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: MED297_11300
Name: PF08856
Funciton: hypothetical protein
Locus tag: MED297_11305
Name: zur
Funciton: Zinc uptake regulation protein ZUR
znuC-znuB-yciC-PF08856-zur -124 5.4 TAAATGATATGATGTATCATAAC MED297_11285
Saccharophagus degradans 2-40
Position: -51
Score: 6.05745
Locus tag: Sde_0059
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: Sde_0058
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Sde_0057
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB -51 6.1 AAAGTGTTATATGATAACATAAC Sde_0059
Teredinibacter turnerae T7901
Position: -51
Score: 5.95491
Locus tag: TERTU_0053
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: TERTU_0052
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: TERTU_0051
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB