Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing zinT gene

Properties
Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chromohalobacter salexigens DSM 3043
Position: -70
Score: 5.33914
Sequence: AGAAAGATATGTTATAACGTATT
Locus tag: Csal_0187
Name: zinT
Funciton: Candidate zinc-binding lipoprotein ZinT
zinT -70 5.3 AGAAAGATATGTTATAACGTATT Csal_0187