Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing znuA gene

Properties
Regulog: Zur - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Cellvibrio japonicus Ueda107
Position: -3
Score: 5.44882
Sequence: GTTATGTTACTCTATAACCTTTC
Locus tag: CJA_3480
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -3 5.4 GTTATGTTACTCTATAACCTTTC CJA_3480
Chromohalobacter salexigens DSM 3043
Position: -63
Score: 5.92134
Sequence: TATATGTTATAACATAACTCTTT
Locus tag: Csal_0188
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -63 5.9 TATATGTTATAACATAACTCTTT Csal_0188
Hahella chejuensis KCTC 2396
Position: -84
Score: 6.32725
Sequence: GATATGTTACATCATAACATTTT
Locus tag: HCH_02942
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -84 6.3 GATATGTTACATCATAACATTTT HCH_02942
Marinobacter aqueolei
Position: -48
Score: 6.29865
Sequence: ATATTGTTATATTATAACGTTTC
Locus tag: Maqu_1892
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -48 6.3 ATATTGTTATATTATAACGTTTC Maqu_1892
Marinobacter sp. ELB17
Position: -68
Score: 5.8443
Sequence: GTTATGTAATATTATAACATTCT
Locus tag: MELB17_08596
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -68 5.8 GTTATGTAATATTATAACATTCT MELB17_08596
Marinomonas sp. MWYL1
Position: -40
Score: 5.9036
Sequence: GTATTGTTACGTTATAACATTAA
Locus tag: Mmwyl1_1122
Name: null
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Mmwyl1_1122 -40 5.9 GTATTGTTACGTTATAACATTAA Mmwyl1_1122
Oceanospirillum sp. MED92
Position: -38
Score: 5.66961
Sequence: TTTGTGTTATATTGTAACTTTAA
Locus tag: MED92_05848
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -38 5.7 TTTGTGTTATATTGTAACTTTAA MED92_05848
Reinekea sp. MED297
Position: -61
Score: 5.61903
Sequence: GTTATGATACATCATATCATTTA
Locus tag: MED297_11280
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -61 5.6 GTTATGATACATCATATCATTTA MED297_11280
Saccharophagus degradans 2-40
Position: -80
Score: 6.04233
Sequence: GTTATGTTATCATATAACACTTT
Locus tag: Sde_0060
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -80 6 GTTATGTTATCATATAACACTTT Sde_0060
Teredinibacter turnerae T7901
Position: -67
Score: 6.12611
Sequence: GTTATGTTATCATATAACGTTTA
Locus tag: TERTU_0054
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA -67 6.1 GTTATGTTATCATATAACGTTTA TERTU_0054