Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.3 --

Orthologous regulated operons containing nadC gene

Regulog: NadQ - Rhizobiales
Regulator type: Transcription factor
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Phylum: Proteobacteria/alpha
Built upon 22 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -2
Score: 5.90559
Locus tag: Atu4098
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: Atu4097
Name: nadB
Funciton: L-aspartate oxidase (EC
Locus tag: Atu4096
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC
nadA-nadB-nadC -2 5.9 ATATGCTCACAATGAGAATAT Atu4098
Bradyrhizobium japonicum USDA 110
Position: -117
Score: 5.87281
Position: -42
Score: 6.45688
Locus tag: bll2542
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: bll2541
Name: nadB
Funciton: L-aspartate oxidase (EC
Locus tag: bll2540
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC
nadA-nadB-nadC -117 5.9 ATTTACTCAGATTGAGCATAT bll2542
Bradyrhizobium sp. BTAi1
Position: -111
Score: 5.71719
Position: -84
Score: 5.88797
Locus tag: BBta_4757
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: BBta_4756
Name: nadB
Funciton: L-aspartate oxidase (EC
Locus tag: BBta_4755
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC
nadA-nadB-nadC -111 5.7 TTATGCTCAGGATAAGTATAA BBta_4757
Mesorhizobium loti MAFF303099
Position: -58
Score: 5.16473
Position: -32
Score: 5.3204
Locus tag: mll5835
Name: nadA1
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: mll5834
Name: nadB1
Funciton: L-aspartate oxidase (EC
Locus tag: mll5833
Name: nadC1
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC
nadA1-nadB1-nadC1 -58 5.2 TTATAGTCACAACGATTATAT mll5835
Mesorhizobium sp. BNC1
Position: -60
Score: 5.18944
Position: -34
Score: 6.12011
Locus tag: Meso_2557
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: Meso_2556
Name: nadB
Funciton: L-aspartate oxidase (EC
Locus tag: Meso_2555
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC
nadA-nadB-nadC -60 5.2 TTATGCTCAGCGCAAGCATAT Meso_2557
Nitrobacter winogradskyi Nb-255
Position: -46
Score: 6.2583
Locus tag: Nwi_2424
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: Nwi_2425
Name: nadB
Funciton: L-aspartate oxidase (EC
Locus tag: Nwi_2426
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC
nadA-nadB-nadC -46 6.3 TTATACTCAATATCAGTATAA Nwi_2424
Rhizobium etli CFN 42
Position: -68
Score: 5.55325
Position: -34
Score: 6.28948
Locus tag: RHE_PE00441
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: RHE_PE00440
Name: nadB
Funciton: L-aspartate oxidase (EC
Locus tag: RHE_PE00439
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC
Rhizobium leguminosarum bv. viciae 3841
Position: -68
Score: 5.57345
Position: -34
Score: 6.16709
Locus tag: pRL110617
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: pRL110616
Name: nadB
Funciton: L-aspartate oxidase (EC
Locus tag: pRL110615
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC
nadA-nadB-nadC -68 5.6 ATATGCTCACGGTGAGAATAT pRL110617
Rhizobium sp. NGR234
Position: -54
Score: 6.75739
Locus tag: NGR_c08490
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: NGR_c08500
Name: nadB
Funciton: L-aspartate oxidase (EC
Locus tag: NGR_c08510
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC
nadA-nadB-nadC -54 6.8 TTATGCTCATATTGAGCATAA NGR_c08490
Rhodopseudomonas palustris CGA009
Position: -186
Score: 5.87146
Position: -48
Score: 6.29777
Locus tag: RPA1055
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: RPA1054
Name: nadB
Funciton: L-aspartate oxidase (EC
Locus tag: RPA1053
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC
Sinorhizobium meliloti 1021
Position: -58
Score: 6.67854
Locus tag: SMc02601
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: SMc02599
Name: nadB
Funciton: L-aspartate oxidase (EC
Locus tag: SMc02598
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC
nadA-nadB-nadC -58 6.7 TTATGCTCAGATTGAGCATAA SMc02601
Xanthobacter autotrophicus Py2
Position: -52
Score: 5.87392
Position: -24
Score: 5.89107
Locus tag: Xaut_1183
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: Xaut_1182
Name: nadB
Funciton: L-aspartate oxidase (EC
Locus tag: Xaut_1181
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC
nadA-nadB-nadC -52 5.9 TTATGCTCAGTATAAGCATAT Xaut_1183