Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing metT gene

Properties
Regulog: SahR - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/delta
Built upon 31 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -131
Score: 5.72692
Sequence: TTATCAACTTAGTTTGATAT
Locus tag: Dde_2476
Name: metT
Funciton: Methionine transporter MetT
metT -131 5.7 TTATCAACTTAGTTTGATAT Dde_2476