Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.3 --

Orthologous regulated operons containing metF gene

Properties
Regulog: SahR - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/delta
Built upon 31 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -69
Score: 4.48738
Sequence: ATATTACAATAGGTCGATAT
Position: -45
Score: 6.20848
Sequence: ATATAAGGCTATCTTGATAT
Locus tag: Dde_2525
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metF -69 4.5 ATATTACAATAGGTCGATAT Dde_2525
-45 6.2 ATATAAGGCTATCTTGATAT
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Position: -80
Score: 6.46068
Sequence: ATATCAATTTATCTTGATAT
Locus tag: Ddes_2008
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metF -80 6.5 ATATCAATTTATCTTGATAT Ddes_2008
Desulfovibrio piger ATCC 29098
Position: -73
Score: 6.23645
Sequence: TTATCAAGTTATATTGATAT
Locus tag: DESPIG_02490
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metF -73 6.2 TTATCAAGTTATATTGATAT DESPIG_02490
Desulfovibrio salexigens DSM 2638
Position: -282
Score: 4.80508
Sequence: ATATAACAATATTTTTATAT
Position: -274
Score: 4.2127
Sequence: ATATTTTTATATATTGAATT
Locus tag: Desal_0813
Name: metE
Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
Locus tag: Desal_0814
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metE-metF -282 4.8 ATATAACAATATTTTTATAT Desal_0813
-274 4.2 ATATTTTTATATATTGAATT
Desulfovibrio vulgaris Hildenborough
Position: -87
Score: 6.39736
Sequence: ATATCAATCTATCTTGATAT
Locus tag: DVU0997
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metF -87 6.4 ATATCAATCTATCTTGATAT DVU0997
Desulfovibrio vulgaris str. Miyazaki F
Position: -208
Score: 6.57713
Sequence: ATATCAAGATAGCTTGATAT
Locus tag: DvMF_3034
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metF -208 6.6 ATATCAAGATAGCTTGATAT DvMF_3034