Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing metK gene

Properties
Regulog: SahR - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/delta
Built upon 31 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -172
Score: 4.7259
Sequence: TTATCAACTTTTTCAGATAT
Locus tag: Dret_2302
Name: sahR
Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: Dret_2301
Name: ahcY
Funciton: Adenosylhomocysteinase (EC 3.3.1.1)
Locus tag: Dret_2300
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
sahR-ahcY-metK -172 4.7 TTATCAACTTTTTCAGATAT Dret_2302
Desulfomicrobium baculatum DSM 4028
Position: -45
Score: 6.71464
Sequence: ATATCAGGATATCTTGATAT
Locus tag: Dbac_2305
Name: sahR
Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: Dbac_2304
Name: ahcY
Funciton: Adenosylhomocysteinase (EC 3.3.1.1)
Locus tag: Dbac_2303
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
sahR-ahcY-metK -45 6.7 ATATCAGGATATCTTGATAT Dbac_2305
Desulfovibrio desulfuricans G20
Position: -18
Score: 5.86775
Sequence: ATATGCGGATACATTGATAT
Locus tag: Dde_1498
Name: panC
Funciton: Pantoate--beta-alanine ligase (EC 6.3.2.1)
Locus tag: Dde_1497
Name: null
Funciton: Uncharacterized conserved protein
Locus tag: Dde_1496
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
panC-Dde_1497-metK -18 5.9 ATATGCGGATACATTGATAT Dde_1498
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Position: -18
Score: 5.79116
Sequence: ATATCACAATACCTTGATAT
Position: -10
Score: 4.24755
Sequence: ATACCTTGATATGCAGATAT
Locus tag: Ddes_2286
Name: panC
Funciton: Pantoate--beta-alanine ligase (EC 6.3.2.1)
Locus tag: Ddes_2287
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
panC-metK -18 5.8 ATATCACAATACCTTGATAT Ddes_2286
-10 4.2 ATACCTTGATATGCAGATAT
Desulfovibrio piger ATCC 29098
Position: -18
Score: 6.09451
Sequence: ATATCACCATACCTTGATAT
Position: -10
Score: 4.24755
Sequence: ATACCTTGATATGCAGATAT
Locus tag: DESPIG_01871
Name: panC
Funciton: Pantoate--beta-alanine ligase (EC 6.3.2.1)
Locus tag: DESPIG_01870
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
panC-metK -18 6.1 ATATCACCATACCTTGATAT DESPIG_01871
-10 4.2 ATACCTTGATATGCAGATAT
Desulfovibrio salexigens DSM 2638
Position: -111
Score: 4.792
Sequence: ATATGCAAATTTATTTATAT
Locus tag: Desal_1278
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
metK -111 4.8 ATATGCAAATTTATTTATAT Desal_1278
Desulfovibrio vulgaris Hildenborough
Position: -18
Score: 5.77158
Sequence: ATATGTGGATAGGTTGATAT
Locus tag: DVU2448
Name: panC
Funciton: Pantoate--beta-alanine ligase (EC 6.3.2.1)
Locus tag: DVU2449
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
panC-metK -18 5.8 ATATGTGGATAGGTTGATAT DVU2448
Desulfovibrio vulgaris str. Miyazaki F
Position: -18
Score: 5.4408
Sequence: ATATTCGGATAACTTGATAT
Locus tag: DvMF_2942
Name: panC
Funciton: Pantoate--beta-alanine ligase (EC 6.3.2.1)
Locus tag: DvMF_2941
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
panC-metK -18 5.4 ATATTCGGATAACTTGATAT DvMF_2942