Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing yteU gene

Properties
Regulog: AraR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Built upon 43 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus halodurans C-125
Position: -49
Score: 4.42753
Sequence: AAACGTGTACGTACACGATA
Locus tag: BH0902
Name: araP
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: BH0903
Name: araQ
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: BH0904
Name: yteU
Funciton: Predicted integral membrane protein
Locus tag: BH0905
Name: araN
Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein
araP-araQ-yteU-araN -49 4.4 AAACGTGTACGTACACGATA BH0902