Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing araK gene

Properties
Regulog: AraR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Built upon 43 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus licheniformis DSM 13
Position: -138
Score: 5.03828
Sequence: ATATTTATATGAACATATTA
Position: -106
Score: 5.78504
Sequence: ACATATGTACGTACAAAAAA
Locus tag: BLi02062
Name: araK
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BLi02063
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BLi02064
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: BLi02065
Name: araE
Funciton: L-arabinose-proton symporter
araK-araD-araA-araE -138 5 ATATTTATATGAACATATTA BLi02062
-106 5.8 ACATATGTACGTACAAAAAA
Bacillus pumilus SAFR-032
Position: -102
Score: 6.06043
Sequence: ACATATGTACGTACAAATAT
Locus tag: BPUM_2329
Name: araK
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BPUM_2328
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BPUM_2327
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: BPUM_2326
Name: araE
Funciton: L-arabinose-proton symporter
araK-araD-araA-araE -102 6.1 ACATATGTACGTACAAATAT BPUM_2329
Oceanobacillus iheyensis HTE831
Position: -152
Score: 5.87614
Sequence: TAATTTGTACGTATATATAT
Position: -119
Score: 5.38375
Sequence: ACAAATGTACGTACAATAAT
Locus tag: OB2799
Name: araK
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: OB2798
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: OB2797
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: OB2796
Name: araE
Funciton: L-arabinose-proton symporter
araK-araD-araA-araE -152 5.9 TAATTTGTACGTATATATAT OB2799
-119 5.4 ACAAATGTACGTACAATAAT
Paenibacillus sp. JDR-2
Position: -100
Score: 4.75903
Sequence: TCACATGTACATACAAGTTA
Locus tag: Pjdr2_4209
Name: araK
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: Pjdr2_4208
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araK-araR -100 4.8 TCACATGTACATACAAGTTA Pjdr2_4209