Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing abf5 gene

Properties
Regulog: AraR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Built upon 43 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: -54
Score: 5.73456
Sequence: AAAAATGTACGTACAAAATT
Locus tag: Aflv_0529
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: Aflv_0530
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: Aflv_0531
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: Aflv_0532
Name: abf5
Funciton: Alpha-L-arabinofuranosidase II precursor
Locus tag: Aflv_0533
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araD-araB-araA-abf5-abfA -54 5.7 AAAAATGTACGTACAAAATT Aflv_0529