Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing xsa gene

Properties
Regulog: AraR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Built upon 43 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus amyloliquefaciens FZB42
Position: -169
Score: 5.56371
Sequence: TAATTGGTTCGTACAAATTA
Locus tag: RBAM_025570
Name: xsa
Funciton: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
xsa -169 5.6 TAATTGGTTCGTACAAATTA RBAM_025570
Bacillus halodurans C-125
Position: -71
Score: 5.71057
Sequence: AAAATTGTACGTACAAGTGT
Locus tag: BH1871
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BH1872
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BH1873
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: BH1874
Name: xsa
Funciton: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
araD-araB-araA-xsa -71 5.7 AAAATTGTACGTACAAGTGT BH1871
Bacillus subtilis subsp. subtilis str. 168
Position: -173
Score: 5.4802
Sequence: AAATACATACGTACAAATAT
Locus tag: BSU28510
Name: xsa
Funciton: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
xsa -173 5.5 AAATACATACGTACAAATAT BSU28510