Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing abfA gene

Properties
Regulog: AraR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Built upon 43 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: -54
Score: 5.73456
Sequence: AAAAATGTACGTACAAAATT
Locus tag: Aflv_0529
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: Aflv_0530
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: Aflv_0531
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: Aflv_0532
Name: abf5
Funciton: Alpha-L-arabinofuranosidase II precursor
Locus tag: Aflv_0533
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araD-araB-araA-abf5-abfA -54 5.7 AAAAATGTACGTACAAAATT Aflv_0529
Bacillus amyloliquefaciens FZB42
Position: -99
Score: 5.83127
Sequence: AAAATTGTTCGTACAAATAA
Position: -57
Score: 5.26869
Sequence: ATATTCGTACGTATATTTTT
Locus tag: RBAM_025860
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: RBAM_025850
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: RBAM_025840
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: RBAM_025830
Name: araL
Funciton: L-arabinose utilization protein
Locus tag: RBAM_025820
Name: egsA
Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
Locus tag: RBAM_025810
Name: araN
Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein
Locus tag: RBAM_025800
Name: araP
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: RBAM_025790
Name: araQ
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: RBAM_025780
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araA-araB-araD-araL-egsA-araN-araP-araQ-abfA -99 5.8 AAAATTGTTCGTACAAATAA RBAM_025860
-57 5.3 ATATTCGTACGTATATTTTT
Bacillus halodurans C-125
Position: -198
Score: 6.12355
Sequence: AAATTTGTACGTACAAAAAA
Position: -100
Score: 5.51212
Sequence: TATTATGTACGTACAAGTTA
Locus tag: BH1861
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: BH1862
Name: egsA
Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
abfA-egsA -198 6.1 AAATTTGTACGTACAAAAAA BH1861
-100 5.5 TATTATGTACGTACAAGTTA
Bacillus licheniformis DSM 13
Position: -155
Score: 5.15606
Sequence: GAAGTTGTTCGTACAAATAT
Position: -125
Score: 5.71286
Sequence: TTAGTTGTACGTACATATAA
Locus tag: BLi03028
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: BLi03027
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BLi03026
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BLi03025
Name: egsA
Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
Locus tag: BLi03024
Name: araN
Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein
Locus tag: BLi03023
Name: araP
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: BLi03022
Name: araQ
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: BLi03021
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araA-araB-araD-egsA-araN-araP-araQ-abfA -155 5.2 GAAGTTGTTCGTACAAATAT BLi03028
-125 5.7 TTAGTTGTACGTACATATAA
Bacillus subtilis subsp. subtilis str. 168
Position: -103
Score: 5.853
Sequence: AAAATTGTTCGTACAAATAT
Locus tag: BSU28800
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: BSU28790
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BSU28780
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BSU28770
Name: araL
Funciton: L-arabinose utilization protein
Locus tag: BSU28760
Name: egsA
Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
Locus tag: BSU28750
Name: araN
Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein
Locus tag: BSU28740
Name: araP
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: BSU28730
Name: araQ
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: BSU28720
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araA-araB-araD-araL-egsA-araN-araP-araQ-abfA -103 5.9 AAAATTGTTCGTACAAATAT BSU28800