Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing araA gene

Regulog: AraR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Built upon 43 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: -54
Score: 5.73456
Locus tag: Aflv_0529
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: Aflv_0530
Name: araB
Funciton: Ribulokinase (EC
Locus tag: Aflv_0531
Name: araA
Funciton: L-arabinose isomerase (EC
Locus tag: Aflv_0532
Name: abf5
Funciton: Alpha-L-arabinofuranosidase II precursor
Locus tag: Aflv_0533
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC
araD-araB-araA-abf5-abfA -54 5.7 AAAAATGTACGTACAAAATT Aflv_0529
Bacillus amyloliquefaciens FZB42
Position: -99
Score: 5.83127
Position: -57
Score: 5.26869
Locus tag: RBAM_025860
Name: araA
Funciton: L-arabinose isomerase (EC
Locus tag: RBAM_025850
Name: araB
Funciton: Ribulokinase (EC
Locus tag: RBAM_025840
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: RBAM_025830
Name: araL
Funciton: L-arabinose utilization protein
Locus tag: RBAM_025820
Name: egsA
Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC
Locus tag: RBAM_025810
Name: araN
Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein
Locus tag: RBAM_025800
Name: araP
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: RBAM_025790
Name: araQ
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: RBAM_025780
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC
araA-araB-araD-araL-egsA-araN-araP-araQ-abfA -99 5.8 AAAATTGTTCGTACAAATAA RBAM_025860
Bacillus halodurans C-125
Position: -71
Score: 5.71057
Locus tag: BH1871
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: BH1872
Name: araB
Funciton: Ribulokinase (EC
Locus tag: BH1873
Name: araA
Funciton: L-arabinose isomerase (EC
Locus tag: BH1874
Name: xsa
Funciton: Alpha-N-arabinofuranosidase 2 (EC
araD-araB-araA-xsa -71 5.7 AAAATTGTACGTACAAGTGT BH1871
Bacillus licheniformis DSM 13
Position: -155
Score: 5.15606
Position: -125
Score: 5.71286
Locus tag: BLi03028
Name: araA
Funciton: L-arabinose isomerase (EC
Locus tag: BLi03027
Name: araB
Funciton: Ribulokinase (EC
Locus tag: BLi03026
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: BLi03025
Name: egsA
Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC
Locus tag: BLi03024
Name: araN
Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein
Locus tag: BLi03023
Name: araP
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: BLi03022
Name: araQ
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: BLi03021
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC
araA-araB-araD-egsA-araN-araP-araQ-abfA -155 5.2 GAAGTTGTTCGTACAAATAT BLi03028
Bacillus pumilus SAFR-032
Position: -102
Score: 6.06043
Locus tag: BPUM_2329
Name: araK
Funciton: Ribulokinase (EC
Locus tag: BPUM_2328
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: BPUM_2327
Name: araA
Funciton: L-arabinose isomerase (EC
Locus tag: BPUM_2326
Name: araE
Funciton: L-arabinose-proton symporter
araK-araD-araA-araE -102 6.1 ACATATGTACGTACAAATAT BPUM_2329
Bacillus subtilis subsp. subtilis str. 168
Position: -103
Score: 5.853
Locus tag: BSU28800
Name: araA
Funciton: L-arabinose isomerase (EC
Locus tag: BSU28790
Name: araB
Funciton: Ribulokinase (EC
Locus tag: BSU28780
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: BSU28770
Name: araL
Funciton: L-arabinose utilization protein
Locus tag: BSU28760
Name: egsA
Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC
Locus tag: BSU28750
Name: araN
Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein
Locus tag: BSU28740
Name: araP
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: BSU28730
Name: araQ
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: BSU28720
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC
araA-araB-araD-araL-egsA-araN-araP-araQ-abfA -103 5.9 AAAATTGTTCGTACAAATAT BSU28800
Geobacillus kaustophilus HTA426
Position: -61
Score: 5.63588
Locus tag: GK1906
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: GK1905
Name: araB
Funciton: Ribulokinase (EC
Locus tag: GK1904
Name: araA
Funciton: L-arabinose isomerase (EC
araD-araB-araA -61 5.6 AAAATTGTACGTACAATAGT GK1906
Oceanobacillus iheyensis HTE831
Position: -152
Score: 5.87614
Position: -119
Score: 5.38375
Locus tag: OB2799
Name: araK
Funciton: Ribulokinase (EC
Locus tag: OB2798
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: OB2797
Name: araA
Funciton: L-arabinose isomerase (EC
Locus tag: OB2796
Name: araE
Funciton: L-arabinose-proton symporter
araK-araD-araA-araE -152 5.9 TAATTTGTACGTATATATAT OB2799
Paenibacillus sp. JDR-2
Position: -83
Score: 5.60097
Locus tag: Pjdr2_2502
Name: araA
Funciton: L-arabinose isomerase (EC
araA -83 5.6 TAAGTTGTACGTACAACTTA Pjdr2_2502