Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing araR gene

Properties
Regulog: AraR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Built upon 43 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: -81
Score: 5.87614
Sequence: AAATATATACGTACAAATAA
Locus tag: Aflv_0528
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR -81 5.9 AAATATATACGTACAAATAA Aflv_0528
Bacillus amyloliquefaciens FZB42
Position: -167
Score: 5.58152
Sequence: ACATTTGTACGTACTTATGA
Position: -124
Score: 5.40942
Sequence: AAATTAGTACGCACAAATAA
Locus tag: RBAM_031330
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR -167 5.6 ACATTTGTACGTACTTATGA RBAM_031330
-124 5.4 AAATTAGTACGCACAAATAA
Bacillus halodurans C-125
Position: -36
Score: 5.22018
Sequence: TCATTTGTACGTATAAGTTG
Locus tag: BH1875
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR -36 5.2 TCATTTGTACGTATAAGTTG BH1875
Bacillus licheniformis DSM 13
Position: -192
Score: 5.78504
Sequence: TTTTTTGTACGTACATATGT
Position: -160
Score: 5.03828
Sequence: TAATATGTTCATATAAATAT
Locus tag: BLi02061
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR -192 5.8 TTTTTTGTACGTACATATGT BLi02061
-160 5 TAATATGTTCATATAAATAT
Bacillus pumilus SAFR-032
Position: -191
Score: 6.06043
Sequence: ATATTTGTACGTACATATGT
Locus tag: BPUM_2330
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR -191 6.1 ATATTTGTACGTACATATGT BPUM_2330
Bacillus subtilis subsp. subtilis str. 168
Position: -91
Score: 5.4564
Sequence: TCAATTGTACGTACTTATAT
Position: -48
Score: 6.00642
Sequence: TAATTAGTACGTACAAATAT
Locus tag: BSU33970
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR -91 5.5 TCAATTGTACGTACTTATAT BSU33970
-48 6 TAATTAGTACGTACAAATAT
Geobacillus kaustophilus HTA426
Position: -75
Score: 4.96238
Sequence: ATAATGATACGGACAAATAA
Locus tag: GK1907
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR -75 5 ATAATGATACGGACAAATAA GK1907
Oceanobacillus iheyensis HTE831
Position: -203
Score: 5.38375
Sequence: ATTATTGTACGTACATTTGT
Position: -170
Score: 5.87614
Sequence: ATATATATACGTACAAATTA
Position: -63
Score: 5.27937
Sequence: AAATATGTACATACAAGTAT
Locus tag: OB2800
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR -203 5.4 ATTATTGTACGTACATTTGT OB2800
-170 5.9 ATATATATACGTACAAATTA
-63 5.3 AAATATGTACATACAAGTAT
Paenibacillus sp. JDR-2
Position: -100
Score: 4.75903
Sequence: TCACATGTACATACAAGTTA
Locus tag: Pjdr2_4209
Name: araK
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: Pjdr2_4208
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araK-araR -100 4.8 TCACATGTACATACAAGTTA Pjdr2_4209