Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing abnA gene

Properties
Regulog: AraR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Built upon 43 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus amyloliquefaciens FZB42
Position: -105
Score: 5.17601
Sequence: TTTTTTGTCTGTACAAATAT
Locus tag: RBAM_025870
Name: abnA
Funciton: Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)
abnA -105 5.2 TTTTTTGTCTGTACAAATAT RBAM_025870
Bacillus subtilis subsp. subtilis str. 168
Position: -159
Score: 5.18073
Sequence: TTTTTTGTCTGTACAAATTA
Locus tag: BSU28810
Name: abnA
Funciton: Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)
abnA -159 5.2 TTTTTTGTCTGTACAAATTA BSU28810