Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing BH1061 gene

Properties
Regulog: AraR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Built upon 43 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus halodurans C-125
Position: -172
Score: 5.57692
Sequence: TTATTCGTACGAACAAATAA
Locus tag: BH1061
Name: BH1061
Funciton: Alpha-glucuronidase (EC 3.2.1.139)
BH1061 -172 5.6 TTATTCGTACGAACAAATAA BH1061