Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing gudD gene

Properties
Regulog: GudR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucarate utilization; Galactarate utilization
Effector:
Phylum: Firmicutes
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus licheniformis DSM 13
Position: -119
Score: 7.00115
Sequence: TTTATTTGTCTTACAATTAAA
Locus tag: BLi00284
Name: kdgD
Funciton: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
Locus tag: BLi00285
Name: kgsD
Funciton: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
Locus tag: BLi00286
Name: gudP
Funciton: Glucarate/galactarate transporter
Locus tag: BLi00287
Name: gudD
Funciton: Glucarate dehydratase (EC 4.2.1.40)
Locus tag: BLi00288
Name: gudR
Funciton: Transcriptional regulator for glucarate/galactarate utilization, GntR family
Locus tag: BLi00289
Name: garD
Funciton: D-galactarate dehydratase (EC 4.2.1.42)
kdgD-kgsD-gudP-gudD-gudR-garD -119 7 TTTATTTGTCTTACAATTAAA BLi00284
Bacillus subtilis subsp. subtilis str. 168
Position: -117
Score: 7.00115
Sequence: TTTATTTGTCTTACAATTAAA
Locus tag: BSU02460
Name: kdgD
Funciton: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
Locus tag: BSU02470
Name: kgsD
Funciton: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
Locus tag: BSU02480
Name: gudP
Funciton: Glucarate/galactarate transporter
Locus tag: BSU02490
Name: gudD
Funciton: Glucarate dehydratase (EC 4.2.1.40)
kdgD-kgsD-gudP-gudD -117 7 TTTATTTGTCTTACAATTAAA BSU02460
Oceanobacillus iheyensis HTE831
Position: -90
Score: 6.59235
Sequence: TTTATTTGTCGGACAAATAAA
Locus tag: OB2842
Name: gudR
Funciton: Transcriptional regulator for glucarate/galactarate utilization, GntR family
Locus tag: OB2841
Name: kdgD
Funciton: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
Locus tag: OB2840
Name: kgsD
Funciton: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
Locus tag: OB2839
Name: tctB_Gud
Funciton: Tripartite tricarboxylate transporter family small permease component, putative transporter for glucarate
Locus tag: OB2838
Name: tctA_Gud
Funciton: Tripartite tricarboxylate transporter family large permease component, putative transporter for glucarate
Locus tag: OB2837
Name: tctC_Gud
Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for glucarate
Locus tag: OB2836
Name: gudD
Funciton: Glucarate dehydratase (EC 4.2.1.40)
gudR-kdgD-kgsD-tctB_Gud-tctA_Gud-tctC_Gud-gudD -90 6.6 TTTATTTGTCGGACAAATAAA OB2842